Language: English
Published by Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
Seller: Ammareal, Morangis, France
£ 5.21
Quantity: 1 available
Add to basketHardcover. Condition: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
Seller: Ammareal, Morangis, France
£ 5.21
Quantity: 1 available
Add to basketSoftcover. Condition: Très bon. Ancien livre de bibliothèque. Légères traces d'usure sur la couverture. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Slight signs of wear on the cover. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
Seller: Ria Christie Collections, Uxbridge, United Kingdom
£ 94.30
Quantity: Over 20 available
Add to basketCondition: New. In.
Condition: New.
Language: English
Published by Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer,, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
Seller: Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, Germany
gr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.
Paperback. Condition: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
Seller: Books Puddle, New York, NY, U.S.A.
Condition: Used. pp. 475 1st Edition.
Language: English
Published by Springer Berlin Heidelberg, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
Seller: moluna, Greven, Germany
Condition: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
Seller: Majestic Books, Hounslow, United Kingdom
Condition: Used. pp. 475.
Seller: Biblios, Frankfurt am main, HESSE, Germany
Condition: Used. pp. 475.
Language: English
Published by Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
Seller: AHA-BUCH GmbH, Einbeck, Germany
Taschenbuch. Condition: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .