Since the publication in 1859 of Darwin's Origin of Species, debate over the theory of evolution has been continuous and often impassioned. In recent years, opponents of "Darwin's dangerous idea" have mounted history's most sophisticated and generously funded attack, claiming that evolution is "a theory in crisis." Ironically, these claims are being made at a time when the explosion of information from genome projects has revealed the most compelling and overwhelming evidence of evolution ever discovered. Much of the latest evidence of human evolution comes not from our genes, but from so-called "junk DNA," leftover relics of our evolutionary history that make up the vast majority of our DNA. Relics of Eden explores this powerful DNA-based evidence of human evolution. The "relics" are the millions of functionally useless but scientifically informative remnants of our evolutionary ancestry trapped in the DNA of every person on the planet. For example, the analysis of the chimpanzee and Rhesus monkey genomes shows indisputable evidence of the human evolutionary relationship with other primates. Over 95 percent of our genome is identical with that of chimpanzees and we also have a good deal in common with other animal species. Author Daniel J. Fairbanks also discusses what DNA analysis reveals about where humans originated. The diversity of DNA sequences repeatedly confirms the archeological evidence that humans originated in sub-Saharan Africa (the "Eden" of the title) and from there migrated through the Middle East and Asia to Europe, Australia, and the Americas. In conclusion, Fairbanks confronts the supposed dichotomy between evolution and religion, arguing that both science and religion are complementary ways to seek truth. He appeals to the vast majority of Americans who hold religious convictions not to be fooled by the pseudoscience of Creationists and Intelligent Design advocates and to abandon the false dichotomy between religion and real science. This concise, very readable presentation of recent genetic research is completely accessible to the nonspecialist and makes for enlightening and fascinating reading.
"synopsis" may belong to another edition of this title.
Daniel J. Fairbanks is a distinguished university professor, research geneticist, artist, and author. He is the coauthor (with A. Franklin, A.W.F. Edwards, D.L. Hartl, and T. Seidenfeld) of The Mendel-Fisher Controversy, and (with W. R. Andersen) of Genetics: The Continuity of Life in addition to numerous journal articles.
Preface.........................................................................7Introduction....................................................................11Chapter 1 Fusion...............................................................17Chapter 2 McClintock's Masterpiece.............................................31Chapter 3 Bogus Genes..........................................................47Chapter 4 Solving the Trichotomy...............................................61Chapter 5 Darwinian DNA........................................................73Chapter 6 A Spectacular Confirmation...........................................87Chapter 7 Diversity............................................................103Chapter 8 The Tree of Life.....................................................121Chapter 9 "When Faith and Reason Clash"........................................133Chapter 10 Abandoning the Dichotomy.............................................161Introduction to the Appendices..................................................173Appendix 1 The Story of NANOG and Its Pseudogenes...............................177Appendix 2 Nine Inversions......................................................189Appendix 3 From Darwin to the Human Genome: A Brief History.....................207Glossary........................................................................245Bibliography....................................................................253Index...........................................................................269
Images of evolution abound, often depicting humans with apes and monkeys. The idea that we are related to other primates gripped the public almost from the day Darwin first published the Origin of Species. On June 30, 1860, just a few months after the first edition of Origin of Species was released, Samuel Wilberforce, the bishop of Oxford, and Thomas Henry Huxley, a staunch supporter of Darwin, engaged in a brisk exchange during a meeting at Oxford University. Years later, Isabella Sidgwick famously recounted the incident with more than a bit of embellishment:
The Bishop rose, and in a light scoffing tone, florid and fluent, he assured us there was nothing in the idea of evolution; rock-pigeons were what rock-pigeons had always been. Then, turning to his antagonist with a smiling insolence, he begged to know, was it through his grandfather or his grandmother that he claimed his descent from a monkey? On this Mr. Huxley slowly and deliberately arose. Aslight tall figure stern and pale, very quiet and very grave, he stood before us, and spoke those tremendous words-words which no one seems sure of now, nor I think, could remember just after they were spoken, for their meaning took away our breath, though it left us in no doubt as to what it was. He was not ashamed to have a monkey for his ancestor; but he would be ashamed to be connected with a man who used great gifts to obscure the truth. No one doubted his meaning and the effect was tremendous. One lady fainted and had to be carried out: I, for one, jumped out of my seat.
Huxley's own recollection, although less spirited than Ms. Sidgwick's, captured the excitement of the moment:
If then, said I, the question is put to me would I rather have a miserable ape for a grandfather or a man highly endowed by nature and possessed of great means of influence and yet who employs those faculties and that influence for the mere purpose of introducing ridicule into a grave scientific discussion -I unhesitatingly affirm my preference for the ape. Whereupon there was inextinguishable laughter among the people -and they listened to the rest of my argument with the greatest attention.
Almost a century and a half later, emotions still run high whether one accepts or scorns the idea of an evolutionary relationship between humans and apes. Setting emotions aside, what does science tell us about the relationship? Specifically, does our DNA hold solid evidence that humans and great apes share common ancestry? This chapter highlights some of the clearest and most powerful evidence, all within a single human chromosome.
HUMAN AND GREAT-APE CHROMOSOMES ARE STRIKINGLY SIMILAR.
The DNA of most organisms, including humans, is contained within structures called chromosomes. Each chromosome is a coiled-up molecule of DNA with proteins that stabilize it. When a cell is about to divide in two, the chromosomes condense into compact structures that are easy to observe with the help of a microscope. Each compact chromosome has a constricted region called a centromere, with very specific DNA sequences in it. The centromere serves a critical role in helping direct the chromosome to its proper position when cells divide. The ends of each chromosome are called telomeres and they, too, contain highly specific DNA sequences.
Each time a chromosome replicates, a bit of telomere DNA erodes away, but a protein called telomerase restores the eroded ends to reconstitute the telomeres. Thus, telomeres function as buffer zones to protect the important DNA within the chromosome from erosion. If not for telomeres and telomerase, our chromosomes would progressively erode inward from the ends until they could no longer function. As we'll see momentarily, these structural features-centromeres and telomeres-offer a compelling clue about our evolutionary history.
If we compare human chromosomes to those of the great apes (chimpanzee, gorilla, and orangutan), one glaring difference stands out: the human genome has one fewer chromosome than the genomes of the great apes. Chimpanzee, gorilla, and orangutan genomes each have twenty-four chromosomes, whereas the human genome has twenty-three. Some opponents of evolution pounced on this difference, claiming that it disproves common ancestry between humans and apes. At one time the difference seemed to justify the traditional classification of great apes into a single family called the Pongidae and humans as the sole surviving species of a different family called the Hominidae. However, DNA analysis eventually shattered that classification (as we'll see later).
In 1982, Jorge Yunis and Om Prakash published what is now viewed as a landmark article in the journal Science. Their work confirmed the findings of several earlier studies in exquisite detail: chromosomes from humans, chimpanzees, gorillas, and orangutans are highly similar and can be aligned with one another. More recently, the human and chimpanzee genome projects confirmed and greatly amplified this comparison, showing that not just the chromosomes but the DNA within the chromosomes of humans and chimpanzees is strikingly similar in both sequence and organization, usually with at least 98 percent identity. All researchers comparing human and chimpanzee chromosomes, and the DNA in them, arrived at the same overall conclusion: every human chromosome, except one, has a matching chimpanzee chromosome. The exception is human chromosome 2, which matches two different chromosomes in chimpanzees as well as in the other great apes.
HOW DID HUMAN CHROMOSOME 2 ORIGINATE?
The two chimpanzee chromosomes that match human chromosome 2 are called 2A and 2B, and their structures and DNA sequences align them along their full lengths with human chromosome 2.
What could explain this curious alignment of two chimpanzee chromosomes with one human chromosome? There are three mutually exclusive possibilities.
First, if humans and chimpanzees share a common ancestor, human chromosome 2 might have formed by the fusion of two chromosomes after the lineage leading to modern humans split from the one leading to modern chimpanzees.
Second, chimpanzee chromosomes 2A and 2B might have resulted from fission (breakage) of an ancestral chromosome into two after the lineages leading to humans and chimpanzees split.
Third, the human and chimpanzee chromosomes may have originated independently with no evolutionary relationship to each other. In this case, the similarity is not a product of common ancestry, merely an illusion of it.
Nine years after Yunis and Prakash published their article, DNA analysis resolved the dilemma, unambiguously supporting one of these three possibilities. To understand how it did, we need a little background information about DNA. DNA molecules contain strands of bases, molecular units that are repeated one after another. There are four different bases in DNA, each designated by the letter representing its chemical name: T, C, A, and G. For example, we can represent a single strand of DNA as a series of letters corresponding to the following base sequence:
ATGGTGCACCTGACTCCTGAGGAGAA
Most DNA molecules contain two strands, which are paired with each other. Wherever there is a T in one strand, an A is paired with it in the other. Wherever there is a C in one strand, a G is paired with it in the other. For example, part of the base sequences in two paired strands of DNA can be written as
ATGGTGCACCTGACTCCTGAGGAGAA TACCACGTGGACTGAGGACTCCTCTT
Every T in one strand is paired with A in the other, and the same is true for G and C.
Now let's turn to the base sequences in telomeres at the ends of chromosomes. Every telomere in human and great-ape chromosomes has the six base-pair sequence
TTAGGG AATCCC
repeated over and over about fifty to one hundred times in tandem:
... TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG ... ... AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC ...
In 1991, scientists at Yale University sequenced the DNA from the site in the middle of human chromosome 2 that matches telomeres at the ends of chimpanzee chromosomes 2A and 2B.
Their findings clearly reveal which of the three explanations is best. In this region is a DNA sequence with 158 copies of the tandem repeat found in telomeres. At some point in human ancestry, the telomere of one chromosome fused head-to-head with the telomere of a different chromosome. The exact fusion site is preserved in the DNA, and figure 1.1 (p. 25) shows all 158 copies of the sequence with the fusion site labeled. The massive sequence in figure 1.1 is a bit daunting, so let's focus just on the fusion site.
... TTAGGGGTTAGGGTTAGCTAACCCTAACCCTAA ... ... AATCCCCAATCCCAATCGATTGGGATTGGGATT ...
To understand how this sequence reveals the exact fusion site, we need to recognize that the two strands of a DNA molecule do not have a "right side up." The repeat found in telomeres is
TTAGGG AATCCC
However, if we rotate the above sequence 180 degrees, it reads
CCCTAA GGGATT
At the fusion site the sequence in the upper strand abruptly changes from repeats resembling TTAGGG to repeats resembling CCCTAA. This abrupt switch is evidence that the DNA in a telomere of one chromosome and the DNA in a telomere of the other chromosome broke and then the two chromosomes fused at the broken ends. Based on evidence of this past event and on what we know about how chromosomes break and fuse in modern times, here's how the fusion process probably took place:
First, the two separate chromosomes had identical telomere sequences with multiple tandem repeats of TTAGGG.
Both chromosomes broke within the telomeres, leaving four base pairs of what was a six base-pair repeat at their broken ends.
The broken ends were ready to fuse with each other, which we can visualize if we rotate one of the chromosomes 180 degrees relative to the other, thereby inverting the DNA sequence. Once the two chromosomes have fused, the DNA sequence matches the fusion site in human chromosome 2.
Chromosome fusion is a very rare event. In fact, one of the functions of intact telomeres is to protect the ends of chromosomes from fusing with each other. However, when two chromosomes break, the protection against fusion is lost and they are free to fuse at the breakage points. There are several documented examples of recent chromosome fusions in humans, one of which is associated with a rare type of Down syndrome. The proportion of people who have recent chromosome fusions is extremely small, but it provides clear evidence that new fusions do occur.
Let's now return to the repeated sequence surrounding the fusion site in figure 1.1. Of the 158 repeats, 44 are perfect copies of TTAGGG or CCCTAA. In most cases, the remaining repeats differ from the standard sequence by no more than one or two base pairs.
This is precisely what we expect if the fusion happened long ago in the remote ancestry of humans. After the fusion event, the repeats no longer functioned as telomeres, so mutations (changes in the DNAsequence) in them had no harmful or beneficial effect. The ancient telomere at the fusion site is now a nonfunctioning relic of evolution embedded in the middle of the chromosome. The more generations humans are separated from the fusion event, the more mutations we expect to accumulate in the sequence. Because the majority of the repeated segments have mutations in them, the chromosomes must have fused a long time ago, probably tens of thousands of generations deep into our ancestry. Thus, the evidence clearly eliminates chromosome fission and independent origins as reasonable alternatives to fusion.
THERE'S STILL MORE EVIDENCE OF FUSION.
These leftover telomere sequences in the middle of chromosome 2 are not the only evidence that this chromosome arose from a fusion. The centromere in human chromosome 2 aligns with the centromere in chimpanzee chromosome 2A, but the centromere in chimpanzee chromosome 2B aligns with a site in human chromosome 2 where there is no centromere.
Fusion at the telomeres should have left two centromeres in the ancient fused chromosome, but there is only one now. Is there any evidence that a centromere was once present at this second site?
In every human and great-ape chromosome, the centromere contains a very specific DNA sequence that is repeated over and over, a 171 base-pair sequence called the alphoid sequence. Two groups of scientists, one in Italy and the other in the United States, searched for alphoid sequences in human chromosomes and found them at every centromere, as expected. They also found alphoid sequences at the site in human chromosome 2 where the remnants of this second centromere should be. These remnants are evidence of a now-defunct centromere.
All copies of the alphoid sequence in this nonfunctioning remnant are mutated when compared to those in functioning centromeres, evidence that this second centromere was disabled long ago in our ancestry, probably at around the time when the two chromosomes fused.
The evidence that human chromosome 2 arose from a fusion, and that it closely matches two chimpanzee chromosomes (as well as two chromosomes in other great apes), is solid and unmistakable. The only reasonable explanation of this evidence is a chromosome fusion that happened after the lineage leading to humans diverged from the lineages leading to the great apes. This solid evidence of our common ancestry with other primates is but the tip of the iceberg. As we are about to see, the human genome is littered throughout with millions of relics that tell an astonishing story of our evolutionary ancestry.
(Continues...)
Excerpted from RELICS OF EDENby Daniel J. Fairbanks Copyright © 2007 by Daniel J. Fairbanks. Excerpted by permission.
All rights reserved. No part of this excerpt may be reproduced or reprinted without permission in writing from the publisher.
Excerpts are provided by Dial-A-Book Inc. solely for the personal use of visitors to this web site.
"About this title" may belong to another edition of this title.
Seller: World of Books (was SecondSale), Montgomery, IL, U.S.A.
Condition: Good. Item in good condition. Textbooks may not include supplemental items i.e. CDs, access codes etc. Seller Inventory # 00099520227
Seller: Zoom Books East, Glendale Heights, IL, U.S.A.
Condition: very_good. Book is in very good condition and may include minimal underlining highlighting. The book can also include "From the library of" labels. May not contain miscellaneous items toys, dvds, etc. . We offer 100% money back guarantee and 24 7 customer service. Seller Inventory # ZEV.1591025648.VG
Seller: Open Books, Chicago, IL, U.S.A.
Hardcover. Condition: Very Good. Open Books is a nonprofit social venture that provides literacy experiences for thousands of readers each year through inspiring programs and creative capitalization of books. Seller Inventory # mon0000773492
Seller: BooksRun, Philadelphia, PA, U.S.A.
Hardcover. Condition: Very Good. Illustrated. With dust jacket. It's a well-cared-for item that has seen limited use. The item may show minor signs of wear. All the text is legible, with all pages included. It may have slight markings and/or highlighting. Seller Inventory # 1591025648-11-18-29
Seller: Better World Books, Mishawaka, IN, U.S.A.
Condition: Good. Former library copy. Pages intact with minimal writing/highlighting. The binding may be loose and creased. Dust jackets/supplements are not included. Includes library markings. Stock photo provided. Product includes identifying sticker. Better World Books: Buy Books. Do Good. Seller Inventory # 4420767-6
Seller: Better World Books: West, Reno, NV, U.S.A.
Condition: Very Good. Former library copy. Pages intact with possible writing/highlighting. Binding strong with minor wear. Dust jackets/supplements may not be included. Includes library markings. Stock photo provided. Product includes identifying sticker. Better World Books: Buy Books. Do Good. Seller Inventory # GRP102810487
Seller: Bellwetherbooks, McKeesport, PA, U.S.A.
hardcover. Condition: Fine. LIKE NEW!!! Has a red or black remainder mark on bottom/exterior edge of pages. Seller Inventory # mon0000052178
Seller: ThriftBooks-Dallas, Dallas, TX, U.S.A.
Hardcover. Condition: Very Good. No Jacket. Former library book; May have limited writing in cover pages. Pages are unmarked. ~ ThriftBooks: Read More, Spend Less. Seller Inventory # G1591025648I4N10
Seller: ThriftBooks-Atlanta, AUSTELL, GA, U.S.A.
Hardcover. Condition: Very Good. No Jacket. May have limited writing in cover pages. Pages are unmarked. ~ ThriftBooks: Read More, Spend Less. Seller Inventory # G1591025648I4N00
Seller: Shakespeare Book House, Rockford, IL, U.S.A.
Condition: new. Seller Inventory # EBBV.1591025648.N