Items related to Creation: The Origin of Life / The Future of Life

Creation: The Origin of Life / The Future of Life - Softcover

 
9780241954690: Creation: The Origin of Life / The Future of Life

Synopsis

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

"synopsis" may belong to another edition of this title.

About the Author

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

"About this title" may belong to another edition of this title.

Buy Used

Condition: Very Good
Shipped within 24 hours from our...
View this item

FREE shipping within United Kingdom

Destination, rates & speeds

Other Popular Editions of the Same Title

Search results for Creation: The Origin of Life / The Future of Life

Stock Image

Adam Rutherford
Published by Penguin 06/02/2014, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Bahamut Media, Reading, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Very Good. Shipped within 24 hours from our UK warehouse. Clean, undamaged book with no damage to pages and minimal wear to the cover. Spine still tight, in very good condition. Remember if you are not happy, you are covered by our 100% money back guarantee. Seller Inventory # 6545-9780241954690

Contact seller

Buy Used

£ 2.78
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin 06/02/2014, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: AwesomeBooks, Wallingford, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Very Good. This book is in very good condition and will be shipped within 24 hours of ordering. The cover may have some limited signs of wear but the pages are clean, intact and the spine remains undamaged. This book has clearly been well maintained and looked after thus far. Money back guarantee if you are not satisfied. See all our books here, order more than 1 book and get discounted shipping. . Seller Inventory # 7719-9780241954690

Contact seller

Buy Used

£ 2.78
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Brit Books, Milton Keynes, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Used; Very Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Seller Inventory # 3631815

Contact seller

Buy Used

£ 3.58
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 3 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Brit Books, Milton Keynes, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Collectible; Very Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Seller Inventory # 4071069

Contact seller

Buy Used

£ 3.58
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Brit Books, Milton Keynes, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Used; Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Seller Inventory # 1444651

Contact seller

Buy Used

£ 3.58
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Greener Books, London, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Used; Good. **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Seller Inventory # 1981903

Contact seller

Buy Used

£ 3.59
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Greener Books, London, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Used; Very Good. **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Seller Inventory # 4499420

Contact seller

Buy Used

£ 3.59
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 4 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Greener Books, London, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Used; Very Good. YELLOW PAGES **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Seller Inventory # 4803434

Contact seller

Buy Used

£ 3.59
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Rutherford, Adam
Published by Penguin Books, Limited, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Better World Books Ltd, Dunfermline, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Very Good. Ships from the UK. Former library book; may include library markings. Used book that is in excellent condition. May show signs of wear or have minor defects. Seller Inventory # 10103157-6

Contact seller

Buy Used

£ 4.69
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 3 available

Add to basket

Stock Image

Rutherford, Adam
Published by Penguin Books, Limited, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Better World Books Ltd, Dunfermline, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Very Good. Ships from the UK. Used book that is in excellent condition. May show signs of wear or have minor defects. Seller Inventory # 40109620-20

Contact seller

Buy Used

£ 4.69
Convert currency
Shipping: FREE
Within United Kingdom
Destination, rates & speeds

Quantity: 1 available

Add to basket

There are 27 more copies of this book

View all search results for this book