Items related to Creation: The Origin of Life / The Future of Life

Creation: The Origin of Life / The Future of Life - Softcover

 
9780241954690: Creation: The Origin of Life / The Future of Life

Synopsis

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

"synopsis" may belong to another edition of this title.

About the Author

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

"About this title" may belong to another edition of this title.

Buy Used

Condition: Good
Item in good condition. Textbooks...
View this item

FREE shipping within U.S.A.

Destination, rates & speeds

Buy New

View this item

FREE shipping from United Kingdom to U.S.A.

Destination, rates & speeds

Other Popular Editions of the Same Title

Search results for Creation: The Origin of Life / The Future of Life

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: World of Books (was SecondSale), Montgomery, IL, U.S.A.

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Good. Item in good condition. Textbooks may not include supplemental items i.e. CDs, access codes etc. Seller Inventory # 00043064151

Contact seller

Buy Used

£ 4.82
Convert currency
Shipping: FREE
Within U.S.A.
Destination, rates & speeds

Quantity: 2 available

Add to basket

Stock Image

Rutherford, Adam
Published by Penguin Books, Limited, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Better World Books, Mishawaka, IN, U.S.A.

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Good. Used book that is in clean, average condition without any missing pages. Seller Inventory # 14502027-6

Contact seller

Buy Used

£ 5.28
Convert currency
Shipping: FREE
Within U.S.A.
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: ThriftBooks-Dallas, Dallas, TX, U.S.A.

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Good. No Jacket. Pages can have notes/highlighting. Spine may show signs of wear. ~ ThriftBooks: Read More, Spend Less. Seller Inventory # G024195469XI3N00

Contact seller

Buy Used

£ 6.11
Convert currency
Shipping: FREE
Within U.S.A.
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: WorldofBooks, Goring-By-Sea, WS, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Very Good. The book has been read, but is in excellent condition. Pages are intact and not marred by notes or highlighting. The spine remains undamaged. Seller Inventory # GOR005657825

Contact seller

Buy Used

£ 0.90
Convert currency
Shipping: £ 5.60
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 6 available

Add to basket

Stock Image

-
Published by -, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: AwesomeBooks, Wallingford, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Very Good. Creation: The Origin of Life / The Future of Life This book is in very good condition and will be shipped within 24 hours of ordering. The cover may have some limited signs of wear but the pages are clean, intact and the spine remains undamaged. This book has clearly been well maintained and looked after thus far. Money back guarantee if you are not satisfied. See all our books here, order more than 1 book and get discounted shipping. Seller Inventory # 7719-9780241954690

Contact seller

Buy Used

£ 2.75
Convert currency
Shipping: £ 4.99
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 3 available

Add to basket

Stock Image

Adam Rutherford
Published by Penguin, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Reuseabook, Gloucester, GLOS, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Used; Very Good. Dispatched, from the UK, within 48 hours of ordering. Though second-hand, the book is still in very good shape. Minimal signs of usage may include very minor creasing on the cover or on the spine. Seller Inventory # CHL1734993

Contact seller

Buy Used

£ 3.14
Convert currency
Shipping: £ 5.50
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

-
Published by - -, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Paperback

Seller: Bahamut Media, Reading, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Paperback. Condition: Very Good. This book is in very good condition and will be shipped within 24 hours of ordering. The cover may have some limited signs of wear but the pages are clean, intact and the spine remains undamaged. This book has clearly been well maintained and looked after thus far. Money back guarantee if you are not satisfied. See all our books here, order more than 1 book and get discounted shipping. Seller Inventory # 6545-9780241954690

Contact seller

Buy Used

£ 3.38
Convert currency
Shipping: £ 6.98
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 3 available

Add to basket

Stock Image

Rutherford, Adam
Published by Penguin Books, Limited, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Better World Books Ltd, Dunfermline, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Very Good. Ships from the UK. Former library book; may include library markings. Used book that is in excellent condition. May show signs of wear or have minor defects. Seller Inventory # 10103157-6

Contact seller

Buy Used

£ 4.71
Convert currency
Shipping: £ 8
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 3 available

Add to basket

Stock Image

Rutherford, Adam
Published by Penguin Books, Limited, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Better World Books Ltd, Dunfermline, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Very Good. Ships from the UK. Used book that is in excellent condition. May show signs of wear or have minor defects. Seller Inventory # 40109620-20

Contact seller

Buy Used

£ 4.71
Convert currency
Shipping: £ 8
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 1 available

Add to basket

Stock Image

Rutherford, Adam
Published by Penguin Books, Limited, 2014
ISBN 10: 024195469X ISBN 13: 9780241954690
Used Softcover

Seller: Better World Books Ltd, Dunfermline, United Kingdom

Seller rating 5 out of 5 stars 5-star rating, Learn more about seller ratings

Condition: Good. Ships from the UK. Former library book; may include library markings. Used book that is in clean, average condition without any missing pages. Seller Inventory # GRP78703612

Contact seller

Buy Used

£ 4.71
Convert currency
Shipping: £ 8
From United Kingdom to U.S.A.
Destination, rates & speeds

Quantity: 1 available

Add to basket

There are 27 more copies of this book

View all search results for this book