Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
"synopsis" may belong to another edition of this title.
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
"About this title" may belong to another edition of this title.
£ 2.20 shipping within United Kingdom
Destination, rates & speedsSeller: WeBuyBooks, Rossendale, LANCS, United Kingdom
Condition: Good. Most items will be dispatched the same or the next working day. A copy that has been read but remains in clean condition. All of the pages are intact and the cover is intact and the spine may show signs of wear. The book may have minor markings which are not specifically mentioned. Ex library copy with usual stamps & stickers. Seller Inventory # rev7111494893
Quantity: 1 available
Seller: WorldofBooks, Goring-By-Sea, WS, United Kingdom
Paperback. Condition: Very Good. The book has been read, but is in excellent condition. Pages are intact and not marred by notes or highlighting. The spine remains undamaged. Seller Inventory # GOR005657825
Quantity: 3 available
Seller: WorldofBooks, Goring-By-Sea, WS, United Kingdom
Paperback. Condition: Good. The book has been read but remains in clean condition. All pages are intact and the cover is intact. Some minor wear to the spine. Seller Inventory # GOR006577698
Quantity: 1 available
Seller: Brit Books, Milton Keynes, United Kingdom
Paperback. Condition: Used; Very Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Seller Inventory # 3631815
Quantity: 3 available
Seller: Brit Books, Milton Keynes, United Kingdom
Paperback. Condition: Used; Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Seller Inventory # 1444651
Quantity: 1 available
Seller: Brit Books, Milton Keynes, United Kingdom
Paperback. Condition: Collectible; Very Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Seller Inventory # 4071069
Quantity: 1 available
Seller: Greener Books, London, United Kingdom
Paperback. Condition: Used; Good. **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Seller Inventory # 1981903
Quantity: 1 available
Seller: Greener Books, London, United Kingdom
Paperback. Condition: Used; Very Good. **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Seller Inventory # 4499420
Quantity: 3 available
Seller: Greener Books, London, United Kingdom
Paperback. Condition: Used; Very Good. YELLOW PAGES **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Seller Inventory # 4803434
Quantity: 1 available
Seller: Better World Books Ltd, Dunfermline, United Kingdom
Condition: Good. Ships from the UK. Former library book; may include library markings. Used book that is in clean, average condition without any missing pages. Seller Inventory # GRP78703612
Quantity: 1 available