Creation: The Origin of Life / The Future of Life
Adam Rutherford
Sold by Gulf Coast Books, Cypress, TX, U.S.A.
AbeBooks Seller since 27 June 2017
New - Soft cover
Condition: New
Ships within U.S.A.
Quantity: 1 available
Add to basketSold by Gulf Coast Books, Cypress, TX, U.S.A.
AbeBooks Seller since 27 June 2017
Condition: New
Quantity: 1 available
Add to basketCreation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
"About this title" may belong to another edition of this title.
If you are a consumer you can withdraw from the contract in accordance with the following. Consumer means any natural person who is acting for purposes which are outside his trade, business, craft or profession.
Information regarding the right of withdrawal
Statutory right to withdraw
You have the right to withdraw from this contract within 14 days without giving any reason.
The withdrawal period will expire after 14 days from the day on which you acquire, or a third party other than the carrier and indicated by you acquires, physical possession of the last good or the last lot or piece.
To exercise the right of withdrawal, electronically fill in and submit a clear statement on our website, under "My Purchases" in "My Account". We will communicate to you an acknowledgement of receipt of such a withdrawal on a durable medium (e.g. by e-mail) without delay.
To meet the withdrawal deadline, it is sufficient for you to send your communication concerning your exercise of the right of withdrawal before the withdrawal period has expired.
Effects of withdrawal
If you withdraw from this contract, we will reimburse to you all payments received from you, including the costs of delivery (except for the supplementary costs arising if you chose a type of delivery other than the least expensive type of standard delivery offered by us).
We may make a deduction from the reimbursement for loss in value of any goods supplied, if the loss is the result of unnecessary handling by you.
We will make the reimbursement without undue delay, and not later than 14 days after the day on which we are informed about your decision to withdraw from this contract.
We will make the reimbursement using the same means of payment as you used for the initial transaction, unless you have expressly agreed otherwise; in any event, you will not incur any fees as a result of such reimbursement.
We may withhold reimbursement until we have received the goods back, or you have supplied evidence of having sent back the goods, whichever is the earliest.
You shall send back the goods or hand them over to Gulf Coast Books, Houston, Texas, U.S.A., without undue delay and in any event not later than 14 days from the day on which you communicate your withdrawal from this contract to us. The deadline is met if you send back the goods before the period of 14 days has expired. You will have to bear the direct cost of returning the goods. You are only liable for any diminished value of the goods resulting from the handling other than what is necessary to establish the nature, characteristics and functioning of the goods.
Exceptions to the right of withdrawal
The right of withdrawal does not apply to:
| Order quantity | 4 to 8 business days | 2 to 6 business days |
|---|---|---|
| First item | £ 0.00 | £ 0.73 |
Delivery times are set by sellers and vary by carrier and location. Orders passing through Customs may face delays and buyers are responsible for any associated duties or fees. Sellers may contact you regarding additional charges to cover any increased costs to ship your items.