The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

"Synopsis" may belong to another edition of this title.

Ria Christie Collections

Uxbridge, United Kingdom

5-star seller

AbeBooks seller since March 25, 2015

Shipping rates from United Kingdom to U.S.A.

Item	6 to 12 business days	6 to 12 business days
First item	£ 9.37	£ 9.37

Delivery times are set by sellers and vary by carrier and location. Orders passing through Customs may face delays and buyers are responsible for any associated duties or fees. Sellers may contact you regarding additional charges to cover any increased costs to ship your items.

Payment methods

Store description

Hello! Ria Christie Collections is an online venture that was initially set up in 2012 to sell books. We do not have a physical high street store. We are professional online booksellers. We only sell brand new books in perfect condition that we source from various suppliers and the publishers. Primarily, our aim is to provide an excellent service to all our customers. We always work as a team to achieve this. Our other objectives are to: 1. Ensure that all our products reach their destination quickly in a safe and secure manner 2. Answer to all our customer queries within 24 hours 3. Ensure that our customers are happy with their purchases 4. Provide all the items at a competitive price 5. Always listen to our customers Ria Christie Collections is not a registered company. It is a Sole Trader venture. Other key information is shown below: Contact Person Name: Rakesh Luchmun (Mr) Storefront Name: Ria Christie Collections Place of Establishment Address: Suite B; ARUN House; ARUN Building Arundel Road Uxbridge UB8 2RR United Kingdom E-Mail Address: riachristie@hotmail.co.uk VAT Number: GB 160 5650 25 We always work hard and aim to comply with all of Abebooks Policies. If you have any issues, please do not hesitate to write to us whether before or after a purchase. We promise to reply to you promptly and, in any case, within 24 hours. Thank you kindly! Yours sincerely Mr Rakesh Luchmun (Founder) and the Ria Christie Collections Team…

Specialty

Educational books, Textbooks, Fiction, Non- fiction

Seller's business information

Ryefield Investments Limited

175 Pield Heath Road
Uxbridge, United Kingdom UB8 3NL

Contact sellerView this seller's itemsView seller's storefront

Terms of sale

All Returns and Refund are as per Abebooks policies.

Right of withdrawal

If you are a consumer you can withdraw from the contract in accordance with the following. Consumer means any natural person who is acting for purposes which are outside his trade, business, craft or profession.

Information regarding the right of withdrawal

Statutory right to withdraw

You have the right to withdraw from this contract within 14 days without giving any reason.

The withdrawal period will expire after 14 days from the day on which you acquire, or a third party other than the carrier and indicated by you acquires, physical possession of the last good or the last lot or piece.

To exercise the right of withdrawal, electronically fill in and submit a clear statement on our website, under "My Purchases" in "My Account". We will communicate to you an acknowledgement of receipt of such a withdrawal on a durable medium (e.g. by e-mail) without delay.

To meet the withdrawal deadline, it is sufficient for you to send your communication concerning your exercise of the right of withdrawal before the withdrawal period has expired.

Effects of withdrawal

If you withdraw from this contract, we will reimburse to you all payments received from you, including the costs of delivery (except for the supplementary costs arising if you chose a type of delivery other than the least expensive type of standard delivery offered by us).

We may make a deduction from the reimbursement for loss in value of any goods supplied, if the loss is the result of unnecessary handling by you.

We will make the reimbursement without undue delay, and not later than 14 days after the day on which we are informed about your decision to withdraw from this contract.

We will make the reimbursement using the same means of payment as you used for the initial transaction, unless you have expressly agreed otherwise; in any event, you will not incur any fees as a result of such reimbursement.

We may withhold reimbursement until we have received the goods back, or you have supplied evidence of having sent back the goods, whichever is the earliest.

You shall send back the goods or hand them over to Ria Christie Collections, Uxbridge, United Kingdom, without undue delay and in any event not later than 14 days from the day on which you communicate your withdrawal from this contract to us. The deadline is met if you send back the goods before the period of 14 days has expired. You will have to bear the direct cost of returning the goods. You are only liable for any diminished value of the goods resulting from the handling other than what is necessary to establish the nature, characteristics and functioning of the goods.

Exceptions to the right of withdrawal

The right of withdrawal does not apply to:

The delivery of newspapers, journals or magazines with the exception of subscription contracts; and
The supply of digital content which is not supplied on a tangible medium (e.g. on a CD or DVD) if you accepted when you placed your order that we could start to deliver it, and that you could not withdraw once delivery had started.

Shipping terms

Orders usually ship within 2 business days. If your book order is heavy or oversized, we may contact you to let you know extra shipping is required. Thank you!

Creation: The Origin of Life / The Future of Life

Item description from seller

Bibliographic details

Synopsis

About the title

About the Author